Part:BBa_K4397001

E22P–Aβ42

Type: RNA

Target: Amyloid-beta 42 Dimer

Binding Affinity: 20 ± 6.0 nM (BLI)

E22P–Aβ42 is RNA aptamer obtained from a preincubated dimer model of E22P–Aβ42, which is dimerized via a linker located at Val-40, as the target of in vitro selection [1]. E22P–AbD43 has preferential affinity toward PFs due to its higher affinity for the toxic dimer unit (KD = 20 ± 6.0 nm) of Aβ42 than for less-toxic Aβ40 aggregates [2]. Preferential binding of E22P–AbD43 toward the dimer might be related to the formation of a G-quadruplex structure [2]. E22P–AbD43 significantly inhibited the nucleation phase of the dimer and its associated neurotoxicity in SH-SY5Y human neuroblastoma cells [2]. Furthermore, in an AD mouse model, E22P–AbD43 preferentially recognized diffuse aggregates, which likely originated from PFs or higher-order oligomers with curvilinear structures, compared with senile plaques formed from fibrils [2].

[1] Farrar, C. T., William, C. M., Hudry, E., Hashimoto, T., & Hyman, B. T. (2014). RNA aptamer probes as optical imaging agents for the detection of amyloid plaques. PLoS One, 9(2), e89901.

[2] Murakami, K., Obata, Y., Sekikawa, A., Ueda, H., Izuo, N., Awano, T., ... & Irie, K. (2020). An RNA aptamer with potent affinity for a toxic dimer of amyloid β42 has potential utility for histochemical studies of Alzheimer's disease. Journal of Biological Chemistry, 295(15), 4870-4880.

Part sequence: gggacgaagaccaactgaactttgtggtggtggcggctactcgtgttcttttgactttgtccgtgccaccttacttc